This web page was created as an assignment for an undergraduate course at Davidson College.
Figure 1. Saccharomyces cerevisiae, or Baker’s yeast.
Permission requested for use of original
image located at
www.ifrn.bbsrc.ac.uk/
CSC/foodreport.html.
There are five IDH genes: IDH1, IDH2, IDP1, IDP2, and IDP3. My molecular biology class plans to clone these five IDH genes from Saccharomyces cerevisiae into a pQE-30 UA, a plasmid vector. In order to accomplish this feat however, certain information is necessary. This web page attempts to describe these genes in the context of this research question by giving both gene and amino acid sequence, accession number, six-cutter restriction sites, PCR primer design, in-frame fusion protein of His6+IDH, and the utilized coenzyme.
|
|
gene sequence
The gene sequence of IDH1 can be identified by searching SGD.
amino acid sequence
The amino acid sequence of IDH1 can be located on NCBI Entrez Protein.
accession number
IDH1 has an accession number of NC_001146 according to NCBI Sequence Viewer.
six-cutter restriction sites
The restriction endonucleases that recognize six-base sequences on IDH1 can be found on SGD’s Yeast Genome Restriction Analysis page.
PCR primer design
The PCR primers for IDH1 amplification are below and can be located at the PCR primers for Yeast IDH genes website.
Forward: 5' ATGCTTAACAGAACAATTGC 3' Tm = 46° C
Reverse: 5' TTACATGGTAGATAATTTGTTG 3' Tm = 46° C
fusion protein
The in-frame fusion protein is as follows: RGSHHHHHHGSHVISSIASMLNRTIAKRT…
RGS-His epitope tag
6xHis tag
MCS I (multiple cloning sites) +
U
first ten amino acids of IDH1
PCR product
coenzyme
IDH1 uses NADH as a coenzyme.
orientation experiment
In order to confirm the insertion of the PCR product into the plasmid in the correct orientation, it is necessary to perform a Southern Blot. If one restriction site is located on the plasmid and another on the inserted gene, then by examining fragment size one can ascertain whether or not the product was inserted in the forward, correct orientation. DNA should be isolated from a single bacterial colony and then digested with the selected restriction enzyme(s). Gel electrophoresis can then be performed to separate the DNA fragments. A Southern blot should then be conducted by blotting the gel with nitrocellulose and then probing it with an appropriate probe.
Eco RV cuts IDH1 into a 340 bp fragment and a 743 bp fragment. Eco RV also cuts pQE-30 UA at a site approximately 15 bp upstream of the PCR product. Correct insertion would yield a fragment that was 355 bp (340+15) and then much larger 4232 bp fragment (3504-15+743) that includes the rest of the gene and the majority of the plasmid. An incorrect, reverse insertion would give a 758 bp and a 3829 bp fragment.
gene sequence
The gene sequence of IDH2 can be identified by searching SGD.
amino acid sequence
The amino acid sequence of IDH2 can be located on NCBI Entrez Protein.
accession number
IDH2 has an accession number of NC_001147 according to NCBI Sequence Viewer.
six-cutter restriction sites
The restriction
endonucleases that recognize six-base sequences on IDH2 can be found on
SGD’s Yeast
Genome Restriction
PCR primer design
The PCR primers for IDH2 amplification are below and can be located at the PCR primers for Yeast IDH genes website.
Forward: 5' ATGTTGAGAAATACTTTTTTTTAG 3' Tm = 45° C
Reverse: 5' TTATAATCTCTTGATGACTG 3' Tm = 44° C
fusion protein
The in-frame fusion protein is as follows: RGSHHHHHHGSHVISSIASMLRNTFFRNT…
RGS-His epitope tag
6xHis tag
MCS I (multiple cloning sites) +
U
first ten amino acids of IDH2
PCR product
coenzyme
IDH2 uses NADH as a coenzyme.
orientation experiment
In order to confirm the insertion of the PCR product into the plasmid in the correct orientation, it is necessary to perform a Southern Blot. If one restriction site is located on the plasmid and another on the inserted gene, then by examining fragment size one can ascertain whether or not the product was inserted in the forward, correct orientation. DNA should be isolated from a single bacterial colony and then digested with the selected restriction enzyme(s). Gel electrophoresis can then be performed to separate the DNA fragments. A Southern blot should then be conducted by blotting the gel with nitrocellulose and then probing it with an appropriate probe.
Bgl II cuts IDH2 into a 775 bp fragment and a 335 bp fragment. Bgl II also cuts pQE-30 UA at a site approximately 18 bp upstream of the PCR product. Correct insertion would yield a fragment that was 793 bp (775+18) and then much larger 3821 bp fragment (3504-18+335) that includes the rest of the gene and the majority of the plasmid. An incorrect, reverse insertion would give a 353 bp and a 4261 bp fragment.
gene sequence
The gene sequence of IDP1 can be identified by searching SGD.
amino acid sequence
The amino acid sequence of IDP1 can be located on NCBI Entrez Protein.
accession number
IDP1 has an accession number of NC_001136 according to NCBI Sequence Viewer.
six-cutter restriction sites
The restriction
endonucleases that recognize six-base sequences on IDP1 can be found on
SGD’s Yeast
Genome Restriction
PCR primer design
The PCR primers for IDP1 amplification are below and can be located at the PCR primers for Yeast IDH genes website.
Forward: 5' ATGAGTATGTTATCTAGAAG 3' Tm = 44° C
Reverse: 5' TTACTCGATCGACTTGATTT 3' Tm = 46° C
fusion protein
The in-frame fusion protein is as follows: RGSHHHHHHGSHVISSIASMSMLSRRLFS…
RGS-His epitope tag
6xHis tag
MCS I (multiple cloning sites) +
U
first ten amino acids of IDP1
PCR product
coenzyme
IDP1 uses NADPH as a coenzyme.
orientation experiment
In order to confirm the insertion of the PCR product into the plasmid in the correct orientation, it is necessary to perform a Southern Blot. If one restriction site is located on the plasmid and another on the inserted gene, then by examining fragment size one can ascertain whether or not the product was inserted in the forward, correct orientation. DNA should be isolated from a single bacterial colony and then digested with the selected restriction enzyme(s). Gel electrophoresis can then be performed to separate the DNA fragments. A Southern blot should then be conducted by blotting the gel with nitrocellulose and then probing it with an appropriate probe.
Bam HI cuts IDP1 into a 780 bp fragment and a 507 bp fragment. Bam HI also cuts pQE-30 UA at a site approximately 27 bp upstream of the PCR product. Correct insertion would yield a fragment that was 807 bp (780+27) and then much larger 3984 bp fragment (3504-27+507) that includes the rest of the gene and the majority of the plasmid. An incorrect, reverse insertion would give a 534 bp and a 4257 bp fragment.
gene sequence
The gene sequence of IDP2 can be identified by searching SGD.
amino acid sequence
The amino acid sequence of IDP2 can be located on NCBI Entrez Protein.
accession number
IDP2 has an accession number of NC_001144 according to NCBI Sequence Viewer.
six-cutter restriction sites
The restriction
endonucleases that recognize six-base sequences on IDH1 can be found on
SGD’s Yeast
Genome Restriction
PCR primer design
The PCR primers for IDP2 amplification are below and can be located at the PCR primers for Yeast IDH genes website.
Forward: 5' ATGACAAAGATTAAGGTAGC 3' Tm = 46° C
Reverse: 5' TTACAATGCAGCTGCCTCGA 3' Tm = 52° C
fusion protein
The in-frame fusion protein is as follows: RGSHHHHHHGSHVISSIASMTKIKVANPI…
RGS-His epitope tag
6xHis tag
MCS I (multiple cloning sites) +
U
first ten amino acids of IDP2
PCR product
coenzyme
IDP2 uses NADPH as a coenzyme.
orientation experiment
In order to confirm the insertion of the PCR product into the plasmid in the correct orientation, it is necessary to perform a Southern Blot. If one restriction site is located on the plasmid and another on the inserted gene, then by examining fragment size one can ascertain whether or not the product was inserted in the forward, correct orientation. DNA should be isolated from a single bacterial colony and then digested with the selected restriction enzyme(s). Gel electrophoresis can then be performed to separate the DNA fragments. A Southern blot should then be conducted by blotting the gel with nitrocellulose and then probing it with an appropriate probe.
Bgl II cuts IDP2 into a 743 bp fragment and a 496 bp fragment. Bgl II also cuts pQE-30 UA at a site approximately 18 bp upstream of the PCR product. Correct insertion would yield a fragment that was 761 bp (743+18) and then much larger 3982 bp fragment (3504-18+496) that includes the rest of the gene and the majority of the plasmid. An incorrect, reverse insertion would give a 514 bp and a 4229 bp fragment.
gene sequence
The gene sequence of IDP3 can be identified by searching SGD.
amino acid sequence
The amino acid sequence of IDP3 can be located on NCBI Entrez Protein.
accession number
IDP3 has an accession number of NC_001146 according to NCBI Sequence Viewer.
six-cutter restriction sites
The restriction
endonucleases that recognize six-base sequences on IDH1 can be found on
SGD’s Yeast
Genome Restriction
PCR primer design
The PCR primers for IDP3 amplification are below and can be located at the PCR primers for Yeast IDH genes website.
Forward: 5' ATGAGTAAAATTAAAGTTGTTCAT 3' Tm = 45° C
Reverse: 5' TTATAGTTTGCACATACCTT 3' Tm = 44° C
fusion protein
The in-frame fusion protein is as follows: RGSHHHHHHGSHVISSIASMSKIKVVHPI…
RGS-His epitope tag
6xHis tag
MCS I (multiple cloning sites) +
U
first ten amino acids of IDP3
PCR product
coenzyme
IDP3 uses NADPH as a coenzyme.
orientation experiment
In order to confirm the insertion of the PCR product into the plasmid in the correct orientation, it is necessary to perform a Southern Blot. If one restriction site is located on the plasmid and another on the inserted gene, then by examining fragment size one can ascertain whether or not the product was inserted in the forward, correct orientation. DNA should be isolated from a single bacterial colony and then digested with the selected restriction enzyme(s). Gel electrophoresis can then be performed to separate the DNA fragments. A Southern blot should then be conducted by blotting the gel with nitrocellulose and then probing it with an appropriate probe.
Cla I cuts IDP3 into a 495 bp fragment and a 768 bp fragment. However, Cla I does not have a restriction site located on pQE-30 UA. Bam HI cuts this plasmid at a site approximately 27 bp upstream of the PCR product. Correct insertion would yield a fragment that was 522 bp (495+27) and then much larger 4245 bp fragment (3504-27+768) that includes the rest of the gene and the majority of the plasmid. An incorrect, reverse insertion would give a 795 bp and a 3972 bp fragment.