Overview

In this example, you will learn how to highlight all Gs and Cs by capitalizing them, find the total number of Gs, Cs and calculate Percentage GC in a sequence

Example Code

Output

GCaCaGGGtGaaCGtaaCGatGGCtGatCGtataaGtGtGaCtatGGCCGaCaCtGataGaGtCaaCttGaCCatGCaCaGGGtGaaCGtaaCG

%GC is : 0.5

Decode

>>Line 10: $sequence=~tr/gc/GC/;

This tr function finds all g and change them into G, and then find all c to change them into C.

>> Line 24: $numberOfG=($sequence=~tr/G/G);

This command returns the total number of G in $sequence.

>>Line 25: $numberOfC=($sequence=~tr/C/C);

This command returns the tatal number of C in $sequence

Exercise Four

>>Write a program that finds the number of As in $sequence. Then change all T in $sequence into A and find the number of As again. Print the results.

$sequence="GCACAGGGTGAACGTAACGATGGCTGATCGTATAAGTGTGACTATGGCCGACACTGATAGAGTCAAC

TTGACCATGCACAGGGTGAACGTAACG ";