July 19, 1994
Dear Colleague,
Enclosed are the GFP clones you asked for (if any are missing, we are temporarily out and will send them soon). I would appreciate hearing about your experiences using GFP (good or bad), so that they can be shared with others. Virtually everything we know about GFP is in the Feb. 11 Science paper.
Good luck with the experiments.
All the best,
Martin Chalfie
MC:leb
All of the vectors contain a PCR amplified cDNA sequence for GFP. The sequence for GFP can be found in D. C. Prasher, V. K. Eckenrode, W.W. Ward, F. G. Prendergast, and M. J. Cormier, Gene 111, 229 (1992). PCR amplification, however, appears to have introduced a change in codon 80 within the coding sequence from CAG to CGG, a change that replaces a glutamine residue with arginine. This change is found in all of the vectors indicated below. The reference for all of these vectors is Martin Chalfie, Yuan Tu, Ghia Euskirchen, William W. Ward, and Douglas C. Prasher, The Aequorea victoria green-fluorescent protein needs no exogenously-added component to fluoresce in prokaryotic and eukaryotic cells, submitted for publication.
1. pGFP10.1
Plasmid pGFP10.1 was formed by placing the EcoR I fragment encoding the GFP cDNA from LAMBDAgfpl0 (5) into pBS(+) (Stratagene). The fragment was obtained by amplification using the polymerase chain reaction with primers flanking the EcoR I sites and subsequent digestion with EcoR I.
2. TU#58
An E. coli expression construct was made by using PCR to generate
a fragment with an Nhe I site at the start of translation and an EcoR
I site 5' to the termination signal of the GFP coding sequence in from
pGFP10.1. The 5' primer was ACAAAGGCTAGCAAAGGAGAAGAAC and the 3' primer
was the T3 primer (Stratagene). The NheI-EcoRI fragment was ligated into
the similarly cut vector pET3a [A.H. Rosenberg et al., Gene 56, 125 (1987)].
The E. coli strain BL21(DE3)LysS [F. W. Studier and B. A. Moffat,
J. Mol . Biol . 189, 113 (1986)] was transformed with TU#58 can be
grown at 37 in the continual presence of 100 µg/ml ampicillin and
0.8 mM IPTG.
3. TU#65
This is a pBluescript II KS (+) derivative that contains a Kpn I - EcoR I fragment encoding GFP with an Age I site 5' to the translation start and a Bsm I site at the termination codon. This fragment by cutting DNA amplified from pGFP10.1 with the following primers (suggested by Andy Fire; the bold sequence is from the GFP coding sequence):
5' primer 5' GGGGTACCGGTAGAAAAAATGAGTAAAGGAGAAGA 3'
3' primer 5'GGGGTACCTGGAATTCTACGAATGCTATTTGTATAGTTCATCC 3'
C. elegans Expression Vectors
The Kpn I - EcoR I fragment encoding GFP from TU#65 replaced a similar fragment containing lacZ in four plasmid made for C. elegans expression studies. These are described in A. Fire, S. W. Harrison, and D. Dixon, Gene 93, 189 (1990).
4. TU#60 replaces the lacZ-containing fragment in pPD16.43
5. TU#61 replaces the lacZ-containing fragment in pPD21.28
6. TU#62 replaces the lacZ-containing fragment in pPD22.04
7. TU#63 replaces the lacZ-containing fragment in pPD22.11
These are notes sent to Dr. A. Malcolm Campbell by Mratin Chalfie from Columbia University, Department of Biology, 19 July, 1994.
Return to Molecular Biology Main Page
© Copyright
2000 Department of Biology, Davidson College, Davidson, NC 28036
Send comments, questions, and suggestions to: macampbell@davidson.edu