Fall 1999 Biology 111 Exam #2 - Genetics, through linkage
There is no time limit on this test, though I have tried to design one that you should be able to complete within 3 hours, except for typing. There are four pages on this test. You are not allowed to use your notes, old tests, any electronic sources, any books, nor are you allowed to discuss the test with anyone until all exams are turned in at 11:30 am on Monday October 18. EXAMS ARE DUE AT CLASS TIME ON MONDAY OCTOBER 18. You may use a calculator and/or ruler. The answers to the questions must be typed on separate sheets of paper unless the question specifically says to write the answer in the space provided. If you do not write your answers on the appropriate pages, I may not find them unless you have indicated where the answers are.
Please do not write or type your name on any page other than this cover page. Staple all your pages (INCLUDING THE TEST PAGES) together when finished with the exam.
Name (please print):
Write out the full pledge and sign:
How long did this exam take you to complete (excluding typing)?
Lab Questions:
4 pts.
1) What Chlamydomonas structure or structures can you see
better with fixed cells than you can with live cells? Give two
reasons why.
3 pts.
2) If we are going to do flagella regeneration again next
lab, why do we have to do a control at all? Why can't we just
do the experimental cells this week and use last week's data as
the control?
3 pts.
3) What is the mating efficiency in this field of view diagramed
below? The formula for this calculation is:
% mating efficiency = 2 (no. of zygotes) ÷ [2 (no. of zygotes) + (no. of gametes)]
Lecture Questions:
| Picture 4A | Picture 4B | Picture 4C |
12 pts.
4) Above are 3 pictures taken from a QT movie of a single
cell during one cell cycle. If I tell you when this cell was in
G1 had 24 chromosomes, answer these questions:
a) what phase is shown in Picture 4A?
b) what is probably happening during this phase?
c) what phase is shown in Picture 4B?
d) what is happening to sister chromatids during this phase?
e) what phase is shown in Picture 4C?
f) what is happening to sister chromatids during this phase?
12 pts.
5) A man and a woman produced 4 children. The first child
is a girl, the next three are boys. The odd numbered children
have a rare genetic phenotype of ears-pointing-backwards (very
advantageous in cold climates with a lot of wind). Child number
one marries a man who also has this phenotype and they have two
wild-type boys.
a) Draw this family pedigree on your answer sheet.
b) Is the disease a dominant, recessive or codominant one? Explain your answer to receive full credit.
c) What were they odds that any couple would have one girl and three boys? Show your work to receive partial credit on wrong answers.
d) What were the odds that the F1 couple would produce two boys that were wild-type? Show your work to receive partial credit on wrong answers.
6 pts.
6) Using the pedigree you have drawn for question 5a, provide
the genotypes of all six children in a way that is consistent
with your answer to question 5b.
9 pts.
7) Define the terms: locus; allele; and gene. Draw a picture
of two chromosomes to demonstrate you understand these terms.
8 pts.
8) Here is a piece of coding DNA:
3' TATACCCCGGGAAACTGCTACAACACATTCCCGGG 5'
a) Write down the RNA strand that would be transcribed from this piece of DNA. Do not worry about post-transcriptional processing at all. Be sure to indicate the 5' and 3' ends on your RNA.
b) Use the code provided on the last page of the test to translate this RNA. Try to be as smart as a ribosome and select the correct reading frame and do not start translating randomly. Indicate which amino acids are on the amino and carboxyl ends.
8 pts.
9) a) What role do transcription factors play in the production
of proteins?
b) What type of genetic disease would you develop if a rogue transcription factor were produced and could not be inactivated?
c) For the woman with the XY karyotype and the SRY nonsense mutation, who did she inherit this from and will she pass it on to her children? Explain your answer.
5 pts.
10) Explain the role of new mutations in evolution. Give at
least one specific example to support your answer.
8 pts.
11) a) Explain how a mutation in a gene's signal sequence
could produce a genetic disease.
b) List two post-translational modifications and tell me if each one could lead to a specific genetic disease or not.
12) Freebie. Skip this one.
5 pts.
13) What was the conclusion drawn from the experiments performed
by Sato and Sato using cAMP and measuring the Cl- concentrations?
Do not tell me methods or results.
5 pts.
14) a) Name three species other than humans whose genomes are
being sequenced as a part of the Human Genome Project.
b) Why is this a good thing to do?
12 pts.
15) There are three traits being examined to see if any are linked.
(The number of children has broken a new world's record.) This
question and your answer must be written using proper Morgan nomenclature.
a) Write the genotypes for the man and woman described below.
b) Determine which traits (if any) are linked.
c) Determine the distance between linked traits if there are any.
Key
A true breeding man with cystic fibrosis, short legs, and albino mated with a woman who was heterozygous for all three traits. They had 200 children!
See Copy of Test with Answers
Return to Bio111 Home Page