DNA Hybridization

By examining the ethidium bromide stained gels, we could determine that a fragment of DNA of the appropriate size was present. To confirm that this fragment of DNA is the desired piece of DNA, it often is necessary to do a Southern blot. Last week, we transferred the DNA from the agarose gel to a piece of nylon membrane and the membrane was stored at 4^oC. This week we will begin the hybridization protocol. In a nutshell, we first will prehybridize the membrane to reduce nonspecific binding of the probe. Then, we will allow a specific probe to hybridize with the transferred DNA. The membrane will be washed to remove unbound and weakly bound probe. Finally, the probe:target DNA complexes will be visualized.

Protocol

Place your membrane in the UV crosslinker, with the DNA side facing up.
Turn on the machine (small switch on front panel).
Push the "optimal crosslinking" button and then the "start" button.
After the crosslinking is completed (<1minute), remove your membrane.
Place membrane in a tray.
Add hybridization solution, prewarmed to 65^oC, to the tray.
Incubate at 65^oC for 2-4 hours.
Add 1 m l biotin-labeled hybridization probe to hybridization solution.
Incubate overnight at 65^oC.

Prehybridization/hybridization solutions

6x SSC
0.01M EDTA (pH 8.0)
5x Denhardt’s solution
0.5% (w/v) sodium dodecyl sulfate (SDS)
100 m g/mL sheared, denatured salmon sperm DNA

Hybridization probe

Biotin-5’ CGATCGTGGCCGGCATCACC 3’

Detection

Hybridize blot with probe overnight at 65^oC
Wash blot with 5x SSC, 0.5% SDS, 2 x 5 minutes, at 65^oC
Wash blot with 0.1x SSC, 0.5% SDS, 30 minutes, at 50^oC
Place membrane in 50mL conical tube

Add 5mL blocking solution and incubate at room temperature for 5 minutes

Blocking solution:

5% SDS
125mM NaCl
17mM Na₂HPO₄
8mM NaH₂PO₄
pH 7.2

Drain blocking solution
Add 5mL streptavidin solution

1m g/mL streptavidin in blocking solution

Incubate 5 minutes at room temperature
Wash 2 x 5 minutes at room temperature with 10mL wash solution I

Wash solution I:

0.5% SDS
12.5mM NaCl
1.7mM Na₂HPO₄
0.8mM NaH₂PO₄
pH 7.2

Add 5mL biotinylated alkaline phosphatase solution

0.5m g/mL biotinylated alkaline phosphatase in blocking solution

Incubate 5 minutes at room temperature
Wash for 5 minutes at room temperature with 10mL blocking solution
Wash 2 x 5 minutes at room temperature with 10mL wash solution II

Wash solution II:

100mM Tris-HCl
100mM NaCl
10mM MgCl₂
pH 9.5

Add 5mL diluted CDP-Star
Incubate 5 minutes at room temperature
Remove membrane from tube and place in detection folder
Expose X-ray film and develop

Alkaline phosphatase catalyzes the removal of a phosphate group from CDP-Star. The resulting product then decays, emitting energy in the form of light, which exposes the X-ray film