Helping Students Discover Genomics, Proteomics and Bioinformatics

Active Learning

1. Students read and access real data using an internet-connected computer.

John Kogoy (’03) reads text and consults internet database.

2. Challenge students to think continuously

• Questions scattered throughout readings rather than saved for the end.
• Questions enrich student understanding and focus their attention.

3. Students use the same databases researchers use.
(e.g. SGD, Expression Connection, Genome Browser, DIP, Protein Data Bank, etc.)

4. Nurture students capacity to think creatively.

• Construct models
• Formulate testable predictions
• Speculate based on available data
• Support their conclusions by citing evidence

Web Resources (The Genomics Place)
www.aw.com/genomics

1. Methods Explained for those with limited exposure to molecular methods. (e.g. Capillary Electrophoresis)

2. Structures Available (e.g. human leptin)

Megan Shafer (’03) wearing 3D goggles for viewing proteins.
StereoEyes (about $500 each) http://www.stereographics.com/

ComWeb device for image distribution.

3. Sequences available for copy and paste into BLAST (e.g. Mycobacterium DNA)

This is the 98 base pair portion of IS6110 that was sequenced and you should use to
perform a BLAST search:

ctcgtccagcgccgcttcggaccaccagcacctaaccggctgtgggta
gcagacctcacctatgtgtcgacctgggcagggttcgcctacgtggc

4. Links to online databases, resources and investigators’ labs.