Bioinformatics Tools for Forming Phylogentic Trees
Go to CLUSTLW web site for
phylogenetic tree creation.
<http://www.ebi.ac.uk/clustalw/>
Submit all 18 sequences for alignment
-
Use the common names you found from BLASTing the sequences to see if this
tree matches your understanding of biology.
-
You will need to make these sequence FASTA format.
FASTA is a standard to communicate the name of the file and the sequence.
FASTA format looks like this:
>Name_of_File
GCATGCATGCATGCATGCAT
Which tree is the better tree? How would you know?
© Copyright 2009 Department of Biology, Davidson College,
Davidson, NC 28036
Send comments, questions, and suggestions to: macampbell@davidson.edu