Bioinformatics Tools for Forming Phylogentic Trees

Go to CLUSTLW web site for phylogenetic tree creation.

<http://www.ebi.ac.uk/clustalw/>

Submit all 18 sequences for alignment

  1. Use the common names you found from BLASTing the sequences to see if this tree matches your understanding of biology.
  2. You will need to make these sequence FASTA format. FASTA is a standard to communicate the name of the file and the sequence. FASTA format looks like this:

>Name_of_File
GCATGCATGCATGCATGCAT

 

Which tree is the better tree? How would you know?

© Copyright 2009 Department of Biology, Davidson College, Davidson, NC 28036
Send comments, questions, and suggestions to: macampbell@davidson.edu